Nucleotide sequence of guinea-pig ϰ-casein cDNA
نویسندگان
چکیده
منابع مشابه
Nucleotide sequence of a cDNA encoding mouse beta casein.
Beta casein 1s a major «1 Ik protein produced by the lactating mammary gland and I t s gene expression 1s hormonally controlled ( 1 ) . cDKAs encoding mouse beta casein wore Isolated from a muse maoaary gland l ibrary prepared as described ( 2 ) , using a short cONA clona of mouse beta casein (1) as a hybridization probe. The longest cDNA clone was chossn and the DNA sequence of each strand was...
متن کاملNucleotide sequence of cDNA encoding for preprochymosin in native goat (Capra hircus) from Iran
Prochymosin is one of the most important aspartic proteinases used as a milk-clotting enzyme in cheese production. In the present investigation we report sequence of cDNA encoding goat ( Capra hircus ) preprochymosin and compare its nucleotide and deduced amino acid sequences with sequences of other ruminants preprochymosin. As bovine prochymosin, the caprine prochymosin cDNA encodes 365 amino ...
متن کاملRapid communication: nucleotide sequence of the river buffalo beta-casein cDNA.
Name of the Sequence. River buffalo kappa-casein cDNA. Genus and Species. Bubalus arnee bubalis. Origin of the Clone. Ten micrograms of total RNA from mammary tissue of lactating buffalo was reverse-transcribed using an oligo d(T)17 primer and superscript II reverse transcriptase (GIBCO-BRL, Grand Island, NY). The forward primer (5′GTGACAAGGAAAGGTGCAATG3′) was designed from conserved regions, t...
متن کاملKaryotype of Hairless Guinea pig
Chromosomal patterns of experimental animals are useful tools for cytogenetics research and animal breeding. Chromosome investigations of the hairless guinea pig are rare, therefore, karyotype of hairless guinea pigs (twelve male and female) was studied using metaphase spreads of bone marrows and G banding techniques. The chromosomes diploid number was 2n= 64 and polymorphism of three type chro...
متن کاملNucleotide coronary vasodilation in guinea pig hearts.
The role of P1 receptors and P2Y1 receptors in coronary vasodilator responses to adenine nucleotides was examined in the isolated guinea pig heart. Bolus arterial injections of nucleotides were made in hearts perfused at constant pressure. Peak increase in flow was measured before and after addition of purinoceptor antagonists. Both the P1 receptor antagonist 8-(p-sulfophenyl)theophylline and a...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
ژورنال
عنوان ژورنال: Nucleic Acids Research
سال: 1990
ISSN: 0305-1048,1362-4962
DOI: 10.1093/nar/18.20.6129